RAPID DNA EXTRACTION AND PCR VALIDATION FOR DIRECT DETECTION OF Listeria monocytogenes IN RAW MILK

Journal Title: Revista MVZ Cordoba - Year 2006, Vol 11, Issue 1

Abstract

Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk. Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, to reduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, to avoid the polymerization. The raw milk samples were analyzed by using the traditional gold standard method for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize the Listeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer sets were use: L1 (CTCCATAAAGGTGACCCT), U1 (CAGCMGCCGCGGTAATWC), LF (CAAACGTTAACAACGCAGTA) and LR (TCCAGAGTGATCGATGTTAA) that recognize the hlyA gene of L. monocytogenes, amplifying a 750bp fragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strains of L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species, respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of 0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of 100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. by using any of the three methods since they share the same sensitivity and specificity. One hundred percent of the predictive value for PCR (alternative method) provides high reliability, and allows the detection of the positive samples. The extraction procedure combined with a PCR method can reduce in 15 days the time of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validated to be use for other types of food such as poultry, meat products and cheeses.

Authors and Affiliations

Edith Burbano| Laboratorio de Microbiología de Alimentos.Grupo de Biotecnología Ambiental e Industrial. Departamento de Microbiología, Facultad de Ciencias. Pontificia Universidad Javeriana. Bogotá. D.C., Sara Sierra| Laboratorio de Microbiología de Alimentos.Grupo de Biotecnología Ambiental e Industrial. Departamento de Microbiología, Facultad de Ciencias. Pontificia Universidad Javeriana. Bogotá. D.C., Kirvis Torres| Laboratorio de Microbiología de Alimentos.Grupo de Biotecnología Ambiental e Industrial. Departamento de Microbiología, Facultad de Ciencias. Pontificia Universidad Javeriana. Bogotá. D.C., Marcela Mercado| Laboratorio de Microbiología de Alimentos.Grupo de Biotecnología Ambiental e Industrial. Departamento de Microbiología, Facultad de Ciencias. Pontificia Universidad Javeriana. Bogotá. D.C., Ana Carrascal| Laboratorio de Microbiología de Alimentos.Grupo de Biotecnología Ambiental e Industrial. Departamento de Microbiología, Facultad de Ciencias. Pontificia Universidad Javeriana. Bogotá. D.C., Raúl Poutou*| Laboratorio de Biotecnología Aplicada.Grupo de Biotecnología Ambiental e Industrial. Departamento de Microbiología, Facultad de Ciencias. Pontificia Universidad Javeriana. Bogotá. D.C.Corresponding author E-mail: rp000274@javeriana.edu.co

Keywords

Related Articles

Evaluation of DNA extraction methods for detection of Listeria monocytogenes in meat products

Objective. To evaluate two methods for extracting DNA from Listeria monocytogenes from artificially contaminated food samples. Materials and methods. The effects of different extraction methods on pure cultures of L. m...

Closed reduction of humeral condylar fracture and elbow luxation in a dog

Fractures of the distal humerus that involving the condyles often requires extensive surgical approach for treatment, leading to a prolonged recovery time. In a West Highland White Terrier dog two years old, with a fract...

Diversity of arbuscular mycorrhizae in grass colosuana (Bothriochloa pertusa (L) A. Camus of livestock farms of the municipality of Corozal- Sucre

Characterize communities of fungi that produce arbuscular mycorrhizal (AMF) in the rhizosphere of the Colosuana grass (Bothriochloa pertusa (L). A. Camus) in cattle farms located in the municipality of Corozal, Sucre.

PCR VALIDATION FOR DETECTION OF Listeria monocytogenes IN RAW BEEF AND CHICKENS

Listeria monocytogenes is a zoonotic emergent microorganism in the food industry, being from great interest for the public health. The aim of this work was to validate the PCR technique for the detection of Listeria mono...

Heritabilities and genetic trends for reproductive traits in a population of Romosinuano cattle in Colombia

Objective. The aim of this study was to estimate heritabilities and genetic trends for reproductive traits in a beef cattle population Romosinuano. Material and methods. Age at first calving (AFC), first calving interval...

Download PDF file
  • EP ID EP3044
  • DOI -
  • Views 432
  • Downloads 21

How To Cite

Edith Burbano, Sara Sierra, Kirvis Torres, Marcela Mercado, Ana Carrascal, Raúl Poutou* (2006). RAPID DNA EXTRACTION AND PCR VALIDATION FOR DIRECT DETECTION OF Listeria monocytogenes IN RAW MILK. Revista MVZ Cordoba, 11(1), 715-724. https://europub.co.uk/articles/-A-3044