RAPID DNA EXTRACTION AND PCR VALIDATION FOR DIRECT DETECTION OF Listeria monocytogenes IN RAW MILK
Journal Title: Revista MVZ Cordoba - Year 2006, Vol 11, Issue 1
Abstract
Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk. Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, to reduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, to avoid the polymerization. The raw milk samples were analyzed by using the traditional gold standard method for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize the Listeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer sets were use: L1 (CTCCATAAAGGTGACCCT), U1 (CAGCMGCCGCGGTAATWC), LF (CAAACGTTAACAACGCAGTA) and LR (TCCAGAGTGATCGATGTTAA) that recognize the hlyA gene of L. monocytogenes, amplifying a 750bp fragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strains of L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species, respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of 0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of 100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. by using any of the three methods since they share the same sensitivity and specificity. One hundred percent of the predictive value for PCR (alternative method) provides high reliability, and allows the detection of the positive samples. The extraction procedure combined with a PCR method can reduce in 15 days the time of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validated to be use for other types of food such as poultry, meat products and cheeses.
Authors and Affiliations
Edith Burbano| Laboratorio de Microbiología de Alimentos.Grupo de Biotecnología Ambiental e Industrial. Departamento de Microbiología, Facultad de Ciencias. Pontificia Universidad Javeriana. Bogotá. D.C., Sara Sierra| Laboratorio de Microbiología de Alimentos.Grupo de Biotecnología Ambiental e Industrial. Departamento de Microbiología, Facultad de Ciencias. Pontificia Universidad Javeriana. Bogotá. D.C., Kirvis Torres| Laboratorio de Microbiología de Alimentos.Grupo de Biotecnología Ambiental e Industrial. Departamento de Microbiología, Facultad de Ciencias. Pontificia Universidad Javeriana. Bogotá. D.C., Marcela Mercado| Laboratorio de Microbiología de Alimentos.Grupo de Biotecnología Ambiental e Industrial. Departamento de Microbiología, Facultad de Ciencias. Pontificia Universidad Javeriana. Bogotá. D.C., Ana Carrascal| Laboratorio de Microbiología de Alimentos.Grupo de Biotecnología Ambiental e Industrial. Departamento de Microbiología, Facultad de Ciencias. Pontificia Universidad Javeriana. Bogotá. D.C., Raúl Poutou*| Laboratorio de Biotecnología Aplicada.Grupo de Biotecnología Ambiental e Industrial. Departamento de Microbiología, Facultad de Ciencias. Pontificia Universidad Javeriana. Bogotá. D.C.Corresponding author E-mail: rp000274@javeriana.edu.co
Heritabilities and genetic trends for reproductive traits in a population of Romosinuano cattle in Colombia
Objective. The aim of this study was to estimate heritabilities and genetic trends for reproductive traits in a beef cattle population Romosinuano. Material and methods. Age at first calving (AFC), first calving interval...
Prevalence of neoplasm in canines in the university of the Llanos, during 2004 to 2007
Objective. Describe and classify neoplastic diseases diagnosed at the Veterinary Pathology Laboratory at the University of the Llanos, between 2004 and 2007. Materials and methods. As a source of information was used dat...
Influence of glyceryl guaiacolate ether on anesthetics in tilapia compared to benzocaine and eugenol
and compare the times of induction, recovery, hematological changes, total protein and glycaemia among anesthetics in Nile tilapia, Oreochromis niloticus. Materials and methods. A total of 60 tilapia distributed in 3 aqu...
Antibacterial activity of the cacao bean husk, Theobroma cacao L
Objective. To test the antibacterial activity of different fractions of cacao bean husk (Theobroma cacao L.). Materials and methods. Antibacterial activity of different fractions of cacao bean husk was analyzed using aga...
IMPORTANCE OF THE USE OF DIFFERENT DIGESTIBILITY TECHNIQUES IN PIG NUTRITION AND FOOD FORMULATION
The nutritional value of a meal for pigs could be expressed using a digestibility coefficient whereas the type of digestibility may be assessed by the point of origin of the sample: 1) ileal Digestibility (IDI), attempts...